|
Left Crispr |
Right Crispr |
| Crispr ID |
1103502633 |
1103502637 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:121415341-121415363
|
12:121415372-121415394
|
| Sequence |
CCTGGCATAGTGGCTCACACTTG |
GCACTTCAGGAGGCCAAGGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 32, 1: 1196, 2: 16048, 3: 56759, 4: 125615} |
{0: 188, 1: 2287, 2: 37127, 3: 142975, 4: 244607} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|