|
Left Crispr |
Right Crispr |
| Crispr ID |
1103502633 |
1103502639 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:121415341-121415363
|
12:121415386-121415408
|
| Sequence |
CCTGGCATAGTGGCTCACACTTG |
CAAGGTAGGCAGATCACTTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 32, 1: 1196, 2: 16048, 3: 56759, 4: 125615} |
{0: 138, 1: 4829, 2: 19432, 3: 48379, 4: 82197} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|