ID: 1103509745_1103509751

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103509745 1103509751
Species Human (GRCh38) Human (GRCh38)
Location 12:121466668-121466690 12:121466683-121466705
Sequence CCCCGGGAGCGCTCCAGCCCCGA AGCCCCGAAGCCGAGGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 101} {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!