ID: 1103518119_1103518132

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1103518119 1103518132
Species Human (GRCh38) Human (GRCh38)
Location 12:121520637-121520659 12:121520686-121520708
Sequence CCAAATCCCCCTAATCCCTCACA GGCAGGTCCCTGAAATCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 259} {0: 1, 1: 0, 2: 3, 3: 18, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!