ID: 1103535770_1103535776

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1103535770 1103535776
Species Human (GRCh38) Human (GRCh38)
Location 12:121633022-121633044 12:121633038-121633060
Sequence CCTGAGGTCAGGCCCAGCATGGG GCATGGGAGGGCTGCCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 78, 4: 680} {0: 1, 1: 0, 2: 2, 3: 25, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!