ID: 1103541985_1103541993

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1103541985 1103541993
Species Human (GRCh38) Human (GRCh38)
Location 12:121672568-121672590 12:121672618-121672640
Sequence CCTGCGCTCACCTGCGGGATCGC GCGCGCGCCGCGGGCCCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 63} {0: 1, 1: 0, 2: 14, 3: 82, 4: 651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!