ID: 1103546328_1103546338

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1103546328 1103546338
Species Human (GRCh38) Human (GRCh38)
Location 12:121704245-121704267 12:121704298-121704320
Sequence CCTCCCAAAGTGCTGGGATTACA GGGTGAGTCACAAATGCATTTGG
Strand - +
Off-target summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!