|
Left Crispr |
Right Crispr |
| Crispr ID |
1103550093 |
1103550099 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:121730533-121730555
|
12:121730565-121730587
|
| Sequence |
CCCAACTACTTGGAAGGCTGAGA |
CACTTCAATCCAGGAGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 721, 2: 14601, 3: 125266, 4: 233031} |
{0: 3, 1: 512, 2: 9337, 3: 41491, 4: 91416} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|