ID: 1103556530_1103556535

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1103556530 1103556535
Species Human (GRCh38) Human (GRCh38)
Location 12:121770071-121770093 12:121770087-121770109
Sequence CCAAAGGCCCTGGGTGAGCCCGC AGCCCGCTGGGTGTAGCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 199} {0: 1, 1: 0, 2: 1, 3: 4, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!