|
Left Crispr |
Right Crispr |
| Crispr ID |
1103580607 |
1103580611 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:121912289-121912311
|
12:121912319-121912341
|
| Sequence |
CCAAAGTGCTGCTATTATAGGCG |
CCGTGCCCGGCGCTTTGTTTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 175, 2: 12862, 3: 168507, 4: 308822} |
{0: 1, 1: 0, 2: 1, 3: 8, 4: 68} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|