ID: 1103589225_1103589234

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1103589225 1103589234
Species Human (GRCh38) Human (GRCh38)
Location 12:121979431-121979453 12:121979471-121979493
Sequence CCAATCGGAATCTCCAAGCACAG TCTCCTGGGGGTGCTCACTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 62} {0: 1, 1: 0, 2: 1, 3: 18, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!