ID: 1103594491_1103594500

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1103594491 1103594500
Species Human (GRCh38) Human (GRCh38)
Location 12:122015868-122015890 12:122015912-122015934
Sequence CCCCCGCCTTACAATAAAGAAAA CCTGTAGTCCCGGCCTCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 309} {0: 1, 1: 0, 2: 14, 3: 165, 4: 1023}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!