ID: 1103595893_1103595900

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1103595893 1103595900
Species Human (GRCh38) Human (GRCh38)
Location 12:122024012-122024034 12:122024029-122024051
Sequence CCCGCAGAGCGGCCAGCTGCTCT TGCTCTGCAGGGAGGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 233} {0: 1, 1: 0, 2: 6, 3: 62, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!