ID: 1103601753_1103601756

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1103601753 1103601756
Species Human (GRCh38) Human (GRCh38)
Location 12:122058915-122058937 12:122058928-122058950
Sequence CCATAGGTCCTCAAACTCTCTGG AACTCTCTGGAGTCCACGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155} {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!