ID: 1103619210_1103619215

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1103619210 1103619215
Species Human (GRCh38) Human (GRCh38)
Location 12:122175961-122175983 12:122175991-122176013
Sequence CCGGCCTCCTTATTCATATTTTA CTTTGATCAGGCCATTTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 764} {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!