ID: 1103623012_1103623015

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1103623012 1103623015
Species Human (GRCh38) Human (GRCh38)
Location 12:122200356-122200378 12:122200378-122200400
Sequence CCATCCACAGGCTGCACTTCTGT TCCTTGTTCCTGTTCCCATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 274} {0: 1, 1: 1, 2: 1, 3: 17, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!