ID: 1103676683_1103676691

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1103676683 1103676691
Species Human (GRCh38) Human (GRCh38)
Location 12:122661352-122661374 12:122661392-122661414
Sequence CCCTGAGGTTGCTGGGACTGCCC TAGAGCGTTGTGATCCCCACGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!