ID: 1103702216_1103702217

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1103702216 1103702217
Species Human (GRCh38) Human (GRCh38)
Location 12:122853780-122853802 12:122853793-122853815
Sequence CCAGGTGGAGGTCTCTGGAAGCC TCTGGAAGCCCTTGCTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 228} {0: 1, 1: 0, 2: 2, 3: 21, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!