ID: 1103716929_1103716942

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1103716929 1103716942
Species Human (GRCh38) Human (GRCh38)
Location 12:122950347-122950369 12:122950387-122950409
Sequence CCAGGGCCTCCCTGGCCCCTGTC CTCCCTTCCCTCCCTGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 77, 4: 746} {0: 1, 1: 0, 2: 7, 3: 77, 4: 639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!