ID: 1103719015_1103719020

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103719015 1103719020
Species Human (GRCh38) Human (GRCh38)
Location 12:122963673-122963695 12:122963694-122963716
Sequence CCTACTAATGCTGAGAAGGGGTC TCTGAGATGCAGAGGGGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63} {0: 1, 1: 1, 2: 5, 3: 41, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!