ID: 1103719324_1103719334

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1103719324 1103719334
Species Human (GRCh38) Human (GRCh38)
Location 12:122965103-122965125 12:122965144-122965166
Sequence CCCACTTCCCTGGGAGGACCCTG TACAGCTGGGGAGACAGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 316} {0: 1, 1: 0, 2: 3, 3: 59, 4: 601}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!