ID: 1103719427_1103719433

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1103719427 1103719433
Species Human (GRCh38) Human (GRCh38)
Location 12:122965529-122965551 12:122965578-122965600
Sequence CCAGCCTCACTCTGGGACTTGAG AGGAGAGGCAGAGAGGCGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 279} {0: 1, 1: 0, 2: 2, 3: 69, 4: 773}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!