ID: 1103757929_1103757935

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1103757929 1103757935
Species Human (GRCh38) Human (GRCh38)
Location 12:123224528-123224550 12:123224574-123224596
Sequence CCCAAAGTGCTGGGATTACAGGC TGCAGTGATCTCAATGGGGAAGG
Strand - +
Off-target summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} {0: 1, 1: 0, 2: 2, 3: 11, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!