ID: 1103763840_1103763843

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1103763840 1103763843
Species Human (GRCh38) Human (GRCh38)
Location 12:123268584-123268606 12:123268607-123268629
Sequence CCAGCTTGGGCTGGAACTGCAAA CGTGGACTTGGATCCTGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 226} {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!