ID: 1103764641_1103764654

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1103764641 1103764654
Species Human (GRCh38) Human (GRCh38)
Location 12:123271597-123271619 12:123271626-123271648
Sequence CCAAGTTCGGTTTGTAAGACATC GGCGGCGGGCGCGCCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39} {0: 1, 1: 3, 2: 29, 3: 200, 4: 1419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!