ID: 1103766505_1103766513

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103766505 1103766513
Species Human (GRCh38) Human (GRCh38)
Location 12:123283967-123283989 12:123283982-123284004
Sequence CCACCCACCTTGCCCTCCCACAG TCCCACAGTGCTGGGATTACAGG
Strand - +
Off-target summary No data {0: 2641, 1: 295980, 2: 261775, 3: 149501, 4: 132181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!