ID: 1103766505_1103766517

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1103766505 1103766517
Species Human (GRCh38) Human (GRCh38)
Location 12:123283967-123283989 12:123283986-123284008
Sequence CCACCCACCTTGCCCTCCCACAG ACAGTGCTGGGATTACAGGCGGG
Strand - +
Off-target summary No data {0: 30, 1: 1872, 2: 2759, 3: 2305, 4: 2305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!