ID: 1103779308_1103779329

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1103779308 1103779329
Species Human (GRCh38) Human (GRCh38)
Location 12:123388878-123388900 12:123388921-123388943
Sequence CCTCCGGAGCGGCCTGGCGGCGC CCGGGCCGGGCGCCGGACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 110} {0: 1, 1: 0, 2: 3, 3: 25, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!