ID: 1103779309_1103779312

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103779309 1103779312
Species Human (GRCh38) Human (GRCh38)
Location 12:123388881-123388903 12:123388902-123388924
Sequence CCGGAGCGGCCTGGCGGCGCCGC GCCCCTACCAGCCCCCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 171} {0: 1, 1: 1, 2: 7, 3: 70, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!