ID: 1103783195_1103783203

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1103783195 1103783203
Species Human (GRCh38) Human (GRCh38)
Location 12:123413203-123413225 12:123413240-123413262
Sequence CCCCAAAAAAAAGCCGGGTGCGG AATCCCAGTGTGTCCGGAATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 58, 4: 366} {0: 14, 1: 19, 2: 62, 3: 181, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!