ID: 1103824190_1103824195

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1103824190 1103824195
Species Human (GRCh38) Human (GRCh38)
Location 12:123723009-123723031 12:123723045-123723067
Sequence CCTGTGCTGCTTATTAGCATCCT CCTCACCCTGTGAAGTAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 134} {0: 1, 1: 0, 2: 1, 3: 66, 4: 1478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!