ID: 1103826360_1103826362

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103826360 1103826362
Species Human (GRCh38) Human (GRCh38)
Location 12:123742244-123742266 12:123742259-123742281
Sequence CCAGGGAGGTTCTTTCTGGCCAT CTGGCCATTTTTGGTGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 160} {0: 1, 1: 0, 2: 3, 3: 51, 4: 537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!