ID: 1103852057_1103852064

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1103852057 1103852064
Species Human (GRCh38) Human (GRCh38)
Location 12:123939858-123939880 12:123939888-123939910
Sequence CCTGGGCACGGCATTGGGCCTGG TGTCCTTCCCCCAGGGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221} {0: 1, 1: 0, 2: 9, 3: 65, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!