ID: 1103852383_1103852385

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1103852383 1103852385
Species Human (GRCh38) Human (GRCh38)
Location 12:123941464-123941486 12:123941482-123941504
Sequence CCACTAAGGCTTGGTGGAAATGG AATGGTCTGTGTCTTTTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107} {0: 1, 1: 0, 2: 1, 3: 15, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!