ID: 1103865990_1103865998

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1103865990 1103865998
Species Human (GRCh38) Human (GRCh38)
Location 12:124052567-124052589 12:124052590-124052612
Sequence CCCCAACACCCCAGATGAACGTG TCAAAGGACGGCTCCCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95} {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!