ID: 1103865995_1103866004 |
View in Genome Browser |
Spacer: 12 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1103865995 | 1103866004 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 12:124052576-124052598 | 12:124052611-124052633 |
| Sequence | CCCAGATGAACGTGTCAAAGGAC | GGCGCTACCATGATGGATTGAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} | {0: 1, 1: 0, 2: 0, 3: 1, 4: 29} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||