ID: 1103865996_1103866001

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1103865996 1103866001
Species Human (GRCh38) Human (GRCh38)
Location 12:124052577-124052599 12:124052604-124052626
Sequence CCAGATGAACGTGTCAAAGGACG CCAGCCCGGCGCTACCATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34} {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!