ID: 1103878999_1103879006

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1103878999 1103879006
Species Human (GRCh38) Human (GRCh38)
Location 12:124151647-124151669 12:124151693-124151715
Sequence CCTGGAAACTGTGTTTATACCCA GGGCAGGTTAATGCAAATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187} {0: 6, 1: 11, 2: 23, 3: 46, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!