|
Left Crispr |
Right Crispr |
| Crispr ID |
1103879001 |
1103879006 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:124151667-124151689
|
12:124151693-124151715
|
| Sequence |
CCACTTTCAATAACATGCAAATT |
GGGCAGGTTAATGCAAATTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 25, 2: 112, 3: 270, 4: 539} |
{0: 6, 1: 11, 2: 23, 3: 46, 4: 157} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|