ID: 1103909983_1103909986

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103909983 1103909986
Species Human (GRCh38) Human (GRCh38)
Location 12:124346749-124346771 12:124346770-124346792
Sequence CCCGTGAGGGCGGTGGGGGCGGA GAGGCGTGCCCTCCCGCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 333} {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!