ID: 1103921068_1103921078

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1103921068 1103921078
Species Human (GRCh38) Human (GRCh38)
Location 12:124399406-124399428 12:124399454-124399476
Sequence CCAGAGATCAGGCAGGAAGAAAG CACCGCCACCAAGAGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 467} {0: 1, 1: 0, 2: 1, 3: 22, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!