ID: 1103921076_1103921083

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1103921076 1103921083
Species Human (GRCh38) Human (GRCh38)
Location 12:124399447-124399469 12:124399479-124399501
Sequence CCAAGTACACCGCCACCAAGAGG AATATCTGCAGGAGCTGCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81} {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!