ID: 1103921080_1103921087

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1103921080 1103921087
Species Human (GRCh38) Human (GRCh38)
Location 12:124399459-124399481 12:124399496-124399518
Sequence CCACCAAGAGGCAGCTGGAAAAT CATAGGCTCTGTGGCCAATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 238} {0: 1, 1: 0, 2: 1, 3: 21, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!