ID: 1103922138_1103922151

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1103922138 1103922151
Species Human (GRCh38) Human (GRCh38)
Location 12:124404557-124404579 12:124404599-124404621
Sequence CCGGCATGGCCAGTAAATGCAGC AGGCAGGGGCCAGTTGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165} {0: 1, 1: 0, 2: 7, 3: 80, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!