ID: 1103926604_1103926612

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1103926604 1103926612
Species Human (GRCh38) Human (GRCh38)
Location 12:124426865-124426887 12:124426911-124426933
Sequence CCCAGGGAAGACACAGAGGGGAC AAAACGCGAAACCAAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 454} {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!