ID: 1103932656_1103932663 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1103932656 | 1103932663 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 12:124458778-124458800 | 12:124458794-124458816 |
| Sequence | CCACCCCTAGGCTTGGGACTAGT | GACTAGTATTTCCGGTGGATGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 93} | {0: 1, 1: 0, 2: 0, 3: 1, 4: 36} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||