ID: 1103937223_1103937230

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103937223 1103937230
Species Human (GRCh38) Human (GRCh38)
Location 12:124483092-124483114 12:124483107-124483129
Sequence CCCAGGGGGCTGCCTGCTGTGCA GCTGTGCAGGGCTCGAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 264} {0: 1, 1: 0, 2: 1, 3: 23, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!