ID: 1103939627_1103939637

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103939627 1103939637
Species Human (GRCh38) Human (GRCh38)
Location 12:124494766-124494788 12:124494787-124494809
Sequence CCCCCTGGAAGCCACCCCAATCC CCTACCCAATACTGCGGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 302} {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!