ID: 1103940368_1103940374

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1103940368 1103940374
Species Human (GRCh38) Human (GRCh38)
Location 12:124498259-124498281 12:124498285-124498307
Sequence CCTGGCACACGCTTACCATGGTG ACGGGCACCAGAGACCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 65} {0: 1, 1: 0, 2: 0, 3: 21, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!