ID: 1104004126_1104004129

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1104004126 1104004129
Species Human (GRCh38) Human (GRCh38)
Location 12:124880236-124880258 12:124880257-124880279
Sequence CCGAGGCGTCTGCCAGGGATGGC GCTGGAGCCCACAGAGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148} {0: 1, 1: 0, 2: 6, 3: 77, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!